Genetic Sequence Comparisons

The following genetic code sequences were intered into the Biology Workbench website...

>Wallaby

ATGGTGCATCTGACTGCTGAGGAGAAGAACGCCATCACCTCCCTGTGGGGTAAGGTAGCCATTGAACAGA

CTGGTGGTGAGGCTCTTGGCAGGCTGCTCATTGTCTACCCATGGACCTCCAGGTTTTTTGACCATTTTGG

TGACCTATCCAATGCCAAGGCTGTCATGTCAAATCCTAAGGTCCTTGCCCATGGTGCTAAGGTGTTAGTT

GCCTTTGGCGATGCCATCAAGAACCTGGACAACCTGAAGGGTACCTTTGCCAAGCTAAGTGAGCTCCATT

GTGACAAACTGCATGTGGACCCTGAGAACTTCAAGCTCCTGGGGAATATCATTGTGATCTGCTTGGCTGA

GCACTTTGGCAAGGAGTTCACCATTGACGCTCAGGTTGCCTGGCAGAAACTCGTGGCTGGTGTGGCCAAT

GCCCTGGCCCACAAGTACCACTAA

>Mouse

GTTTACGTTTGCTTCTGATTCTGTTGTGTTGACTTGCAACCTCAGAAACAGACATCATGGTGCACCTGAC

TGATGCTGAGAAGGCTGCTGTCTCTGGCCTGTGGGGAAAGGTGAACGCCGATGAAGTTGGTGGTGAGGCC

CTGGGCAGGCTGCTGGTTGTCTACCCTTGGACCCAGCGGTACTTTGATAGCTTTGGAGACCTATCCTCTG

CCTCTGCTATCATGGGTAATGCCAAAGTGAAGGCCCATGGCAAGAAAGTGATAACTGCCTTTAACGATGG

CCTGAATCACTTGGACAGCCTCAAGGGCACCTTTGCCAGCCTCAGTGAGCTCCACTGTGACAAGCTGCAT

GTGGATCCTGAGAACTTCAGGCTCCTGGGCAATATGATCGTGATTGTGCTGGGCCACCACCTGGGCAAGG

ATTTCACCCCCGCTGCACAGGCTGCCTTCCAGAAGGTGGTGGCTGGAGTGGCTGCTGCCCTGGCTCACAA

GTACCACTAAGCCCCTTTTCTGCTATTGTCTATGCACAAAGGTTATATGTCCCCTAGAGAAAAACTGTCA

ATTGTGGGGAAATGATGAAGACCTTTGGGCATCTAGCTTTTATCTAATAAATGATATTTACTGTCATCCC

>Human

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA

GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC

AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG

CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC

TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT

CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA

CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA

CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT

GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

>Chimp

GGACAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGT

GGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC

CCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG

GCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCT

TTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAA

CGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAG

AAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAAT

TTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGC

ATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

>Chicken

GCTCAGACCTCCTCCGTACCGACAGCCACACGCTACCCTCCAACCGCCGCCATGGTGCACTGGACTGCTG

AGGAGAAGCAGCTCATCACCGGCCTCTGGGGCAAGGTCAATGTGGCCGAATGTGGGGCCGAAGCCCTGGC

CAGGCTGCTGATCGTCTACCCCTGGACCCAGAGGTTCTTTGCGTCCTTTGGGAACCTCTCCAGCCCCACT

GCCATCCTTGGCAACCCCATGGTCCGCGCCCACGGCAAGAAAGTGCTCACCTCCTTTGGGGATGCTGTGA

AGAACCTGGACAACATCAAGAACACCTTCTCCCAACTGTCCGAACTGCATTGTGACAAGCTGCATGTGGA

CCCCGAGAACTTCAGGCTCCTGGGTGACATCCTCATCATTGTCCTGGCCGCCCACTTCAGCAAGGACTTC

ACTCCTGAATGCCAGGCTGCCTGGCAGAAGCTGGTCCGCGTGGTGGCCCATGCCCTGGCTCGCAAGTACC

ACTAAGCACCAGCACCAAAGATCACGGAGCACCTACAACCATTGCATGCACCTGCAGAAATGCTCCGGAG

CTGACAGCTTGTGACAAATAAAGTTCATTCAGTGACACTCA

>Goldfish

GTGGAGTGGACGGATGCTGAGCGAAGTGCCATCATTGGCCTGTGGGGAAAGCTCAATCCCGCTGAACTCG

GACCTCAGGCCCTGGCCAGGTGTCTGATCGTGTATCCCTGGACTCAGAGATATTTCGCCACCTTTGGGAA

CCTGTCAAGCCCCGCTGCAATCATGGGTAACCCCAAGGTGGCAGCTCACGGCAGGACTGTGATGGGAGGT

CTGGAGAGAGCCATCAAGAACATGGATAACATCAAGGCCACCTATGCGCCACTCAGTGTGATGCACTCTG

AGAAATTGCATGTGGATCCCGACAACTTCAGGCTCCTGGCTGATTGCATCACCGTGTGCGCTGCCATGAA

GTTTGGCCCATCTGGGTTCAATGCTGACGTCCAGGAGGCCTGGCAGAAGTTTCTGTGTGTCGTCGTTTCC

GCTCTGTGCAGACAATACCAT

EXPLORING MOLECULAR EVOLUTION

STUDENT WORKSHEET

Results of your pairwise alignment comparing the beta globin gene in humans and in chimps:

1. Data about the alignment can be found below the blue/black alignment chart. How many nucleotides are there in the beta globin gene for:
1. The chimp?

               600

2. The human?

               626

2. A blue asterix indicates that the nucleotides in both sequences are the same, we say they are conserved. What percentage of the beta globin sequence is conserved in chimps and humans? (Don’t include the insertion at the beginning of the human gene). This percentage is often reported as a similarity “score” below the alignment.

               99% similarity between chimps and humans!

3. Would you expect the protein structure to be highly similar or markedly different in the chimp and the human? Explain.

               I think that the protein structure between chimps and humans would be quite similar since their DNA is 99% similar. Their build is much alike. There are a few differences in specific details (such as how much hair), but the proteins would be very much like each other.

RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS

Results of your pairwise alignment comparing the beta globin gene in humans and in chickens:

1. What is the percentage of sequence conservation between the beta globin gene in chickens and humans?

               57%

2. Looking at the two pairwise alignments you have performed, would you expect the beta globin protein found in humans to be more similar to that found in chickens or that found in chimps? Explain.
   
   

              I would expect the protein in humans to be more like that in chimps than chickens. This is because their DNA has been proven to be more alike.

3. Do the results achieved by running these alignments support the results on evolutionary relationships determined by scientists using anatomical homology (similarities)? Explain.  
   
   

               This does support evolutionary relationships that scientists have come up with! It's been said that humans are similar to chimps. But when one thinks about humans being a lot like chickens...things just don't add up. This information proves that humans and chimps are very much alike!

RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS

Results of your multiple sequence alignment comparing the beta globin gene in a variety of animal species:

1. Examine the Unrooted Tree produced.  

Record the species at the end of each branch on the unrooted tree shown below.

2. Based on the information in the unrooted tree:

1. Which two species appear to be most closely related to each other? Explain your choice.

             Humans and chimps appear to be closest related because they are on the same branch.

2. Which two species seem to be the least closely related to each other? Explain your choice.

               The wallaby and the human appear to be quite similar because the wallaby has its own node and the human, two.

3. Comparative evolutionary distance between species is indicated by the length of the clades they are on. Give the comparative evolutionary distance (by percentage similarity “score”) between:

1. The mouse and human

               79% with 630 bp

2. The wallaby and the human

               75% with 444 bp

3. The chimp and the human

               99% with 600 bp

Comment on the significance of these results given your knowledge of mammalian groups.

               Humans are more closely related to chimps than a mouse or wallaby.

RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS

Results of your Rooted Phylogenetic Tree:

1. Examine your Rooted Phylogenetic Tree and record the species at the end of each branch.  

2. Based on this tree diagram, which species is/are most closely related to:

1. The goldfish:

               Chicken

2. The mouse:

               Chimp or human

3. Homology is a term used to refer to a feature in two or more species that is similar because of descent; it evolved from the same feature in the last common ancestor of the species. Hence, similarity in DNA or protein sequences between individuals of the same species or among different species is referred to as sequence homology. Which two species in the tree above share greatest homology with respect to the beta globin gene?

               Human and chimp could be homology.

4. A node is a branch point representing a divergence event from a common ancestor. Which two species have the most ancestral nodes (divergence events) in the tree above? Explain your answer giving the number of nodes leading to these species.

               Human and chimp have the most ancestral nodes. There were two after the first one.

5. Looking at the phylogentic tree above, which two organisms:

1. Diverged from their common ancestor most recently?

               Human and chimp

2. Diverged from their common ancestor least recently?

               Wallaby

6. Draw a modified phylogenetic tree to show how the tree above might change if the beta globin gene for a kangaroo was added to the multiple sequence alignment.

7. It is important to understand that the phylogenetic trees you generated using bioinformatics tools are based on sequence data alone. While sequence relatedness can be very powerful as a predictor of the relatedness of species, other methods must be used in addition to sequence homology, to determine evolutionary relationships. Briefly describe 3 other methods that you think might be used to determine evolutionary relationships.

• The way the species look and reproduce

• Fossils-fossils show lots of different things found that can reveal new species (new...!)

• Breeding-when different animals breed with each other, new species are bound to be born!
  
  

DNA Extraction from Wheat Germ

Instructions:

1. Place 1 gram of raw wheat germ in 50 ml test tub.

2. Add 20 ml of hot (50-60 C) tap water and mix constantly for 3 minutes.

3. Add 1 ml or a scant 1/4 teaspoon of detergent and mix gently every minut for 5 minutes. Try not to create foam.

4. Use an eyedropper, pipette, or piece of paper towel to remove any foam from the top of the solution.

5. Tilt the test tube at an angle. SLOWLY pour 14 ml of alcohol down the side so that it forms a layer on top of the water/wheat germ/detergent solution. Do not mix the two layers together. DNA precipitates at the water-alcohol interface (the boundary between the water and the alcohol). Therefore, it is crucial to pour the alcohol very slowly so that it forms a layer on top of the water solution. If the alcohol mixes with the water, it will become too dilute and the DNA will no precipitate.

6. Let the test tube sit for a few minutes. White, stringly, filmy DNA will begin to appear where the water and alcohol meet. You will usually see DNA precipitating from the solution at the water-alcohol interface as soon as you pour in the alcohol. If you let the preparation sit for 15 minutes or so, the DNA will float to the top of the acohol.
     You can usually get more DNA to precipitate from the solution by using one of the DNA-collecting tools (such as glass or paper clip hook) to gently lift the water solution up into the alcohol. This allows more DNA to come in contact with the alcohol and precipitate. You may find it helpful to pour the water/detergent solution into a clean test tube, leaving behind the wheat germ, before adding the alcohol.

7. Use a glass or paper clip hook or wooden stick to collect the DNA.

OBSERVATIONS

1. What does the "wheat germ soup" look like?
     The "wheat germ soup" looks much like watery snot...interesting....different.

2. How does its appearance change as you add the detergent and swirl it in?
     The "snot look" begins to form. The DNA, or "stringy parts" start to develop.

3. What do you think is happening at this step?
     The DNA is beginning to form.

4. Describe the appearance of the mixture just after you add the alcohol.
     The two solutions are separate, but in the same tube. It looks layered.

5. What do you think is happening at this step?
     The two solutions are separating so that DNA can form in between them. They're working as glues.

6. What do you observe at the water-alcohol interface?
     The wheat germ met the alcohol, so that's where the filmy DNA film started forming.

7. What does DNA look like?
     The DNA looks like snot. Creation of life is beautiful...but really not too pretty!

Let's Make A Baby!

     For this experiment, my classmates and I were to partner up and make a baby! Not literally-but on paper with the cool, fun techniques of biology! As my class evened out to an ODD number of students that day, we decided that it would only be fair to make my partner the great and glorious Enrique Iglecias!

(Two pretty attractive people, we know!)

So for this project, my partner and I were to look at each others' faces and match up listed features on the page in order to decide upon which features our child will likely have. This helped us determine exactly how our child will look.

A long and tough process, but we were able to define each others' beautiful traits our child would probably be getting.














Following are the final results...

(Adorable!!)

Metabolism Intro Notes

Forms of Energy
    Law of thermodynamics
    Metabolic reactions
ATP
Metabolic Pathways
-energy of activation-enzymes
-photosynthesis
-cellular respiration


2 Types of energy:
Kinetic
-energy of motion
-mechanical

Potential
-Stored energy
-chemical


Laws of Thermodynamics
First law:
-law of conservation of energy
-energy cannot be created or destroyed
-energy CAN be changed from one form to another
Second Law:
-Law of Entropy
-when energy is changed from one form to another, there is a loss of usable energy
-waste energy goes to increase disorder

Metabolic Reactions and Energy Transformations
Metabolism:
-sum of cellular chemical reactions in cell
-reactants participate in reaction
-products form as result of reaction
Free energy s the amount of energy available to perform work
-Exergonic Reactions-Products have less free energy than reactants
-Endergonic reactions-Products have more free energy than reactants

ATP and Coupled Reactions
Adensonine Triphosphate (ATP)
-High energy compound used to drive metabolic reactions
-constantly being generated from adenosine diphosphate (ADP)
Composed of:
-adenine and ribose (together=adensosine)
-three phosphate groups
Coupled reactions
-energy released by an exergonic reaction captured in ATP
-that ATP used to drive an endergonic reaction

ATP= ADP + P + Energy



Work-Related Functions of ATP
Primarily to perform cellular work
-Chemical work-Energy needed to synthesize macromolecules
-Transport work-Energy needed to pump substances across plasma membrane
-Mechanical work-Energy needed to contract

Metabolic Pathways
-Products of an earlier reaction become reactants of a later reaction
-Such linked reactions form a metabolic pathway
   -Begins with a particular reactant
   -Proceeds through several intermediates
   -Terminates with a particular end product

Enzymes
-Protein molecules that function as catalysts
-the reactants of an enzymatically accelerated reaction are called substrates
-each enzyme accelerates a specific reaction
-each reaction in a metabolic pathway requires a unique and specific enzyme
-end product will not appear unless ALL enzymes present and functional

Enzymes: Energy of Activation
Reactants often "reluctant" to participate in reaction
-energy must be added to at least one reactant to initiate the reaction
-energy of activation
Enzyme Operation:
-Enzymes operate by lowering the energy of activation
-Accomplished by bringing the substances


Irreversible Inhibition
Materials that irreversibly inhibit an enzyme are known as poisons
Cyanides inhibit enzymes resulting in all ATP production
Penicillin inhibits an enzyme unique to certain bacteria
Heavy metals irreversible bind with many enzymes
Nerve gas irreversibly inhibits enzymes required by nervous system

Cystic Fibrosis Research

CYSTIC FIBROSIS - A DISORDER OF MEMBRANE TRANSPORT

A great variety of proteins have roles in moving molecules and ions across cell membranes. Passive transport proteins permit certain substances to diffuse down concentration gradients by moving through the protein's interior. Active transport proteins use ATP energy to pump substances across the membrane against their concentration gradients. To investigate the importance of transport proteins, we will consider the effects of cystic fibrosis, a genetic disorder in which there is a defect in a transport protein..
Activity

Part 1.

In this part of the activity you will visit the Cystic Fibrosis Foundation’s web site to learn about the causes and symptoms of cystic fibrosis.
Use your browser to go to http://www.cff.org/home/
Use the information provided in the “About cystic fibrosis” section to answer the following questions:


1. What are the signs and symptoms of cystic fibrosis?

very salty-tasting skin;

persistent coughing, at times with phlegm;

frequent lung infections;

wheezing or shortness of breath;

poor growth/weight gain in spite of a good appetite; and

frequent greasy, bulky stools or difficulty in bowel movements.

2. How common is this disorder?

About 1,000 new cases of cystic fibrosis are diagnosed each year.

More than 70% of patients are diagnosed by age two.

More than 45% of the CF patient population is age 18 or older.

The predicted median age of survival for a person with CF is in the late 30s.

3. How is cystic fibrosis diagnosed?
Most people are diagnosed as babies, or before the age of 2 through screening. A sweat test (the more commonly used test) or a genetic test with be performed to determine whether or not it is there.

4. How is cystic fibrosis inherited? Does everyone who has a mutant gene for the protein have cystic fibrosis?

One protein is different for that person. They have inherited two copies of the defective gene. One can have the CF gene, but that does not necessarily mean that they have CF.

Part 2.

In this part of the activity you will read an article to learn more about cystic fibrosis.
Use your browser to go to:
http://resources.schoolscience.co.uk/MRC/3/page3.html
Use the information in this article to answer the following questions:
1. Explain the normal function of the protein that is defective in cystic fibrosis.
This gene will typically show up in the epithelial cells that line the airways of the lungs. There are channels for those cells that allow ions to flow in. This brings the water to the surface and keeps mucus moist. The gene will prevent those from getting moist, leaving them all dried out. This makes it easier for those people to get infections. They need some extra care for that!

2. What happens to this protein in CF patients and what are the consequences for the health of these individuals?
Movement of chloride ions into the mucus are cut off. Sodium ions are allowed to then flow into the cell, allowing it for drying out more. Bad news! That person is then prone to infection.

Part 3.

In this part of the activity you will read about how cystic fibrosis is treated.
Use your browser to go to:
http://www.mayoclinic.com/health/cystic-fibrosis/DS00287
Use the information in the different sections of the article to answer the following questions:
1. Explain at least 3 treatments for the symptoms of cystic fibrosis.
Medications, chest therapy, organ function tests

2. Discuss at least 3 ways for parents to help their children who have cystic fibrosis.

Healthy eating, exercise, and drinking lots of fluid would be great ways to help support and keep their child healthy!