Genetic Sequence Comparisons

The following genetic code sequences were intered into the Biology Workbench website...

>Wallaby

ATGGTGCATCTGACTGCTGAGGAGAAGAACGCCATCACCTCCCTGTGGGGTAAGGTAGCCATTGAACAGA

CTGGTGGTGAGGCTCTTGGCAGGCTGCTCATTGTCTACCCATGGACCTCCAGGTTTTTTGACCATTTTGG

TGACCTATCCAATGCCAAGGCTGTCATGTCAAATCCTAAGGTCCTTGCCCATGGTGCTAAGGTGTTAGTT

GCCTTTGGCGATGCCATCAAGAACCTGGACAACCTGAAGGGTACCTTTGCCAAGCTAAGTGAGCTCCATT

GTGACAAACTGCATGTGGACCCTGAGAACTTCAAGCTCCTGGGGAATATCATTGTGATCTGCTTGGCTGA

GCACTTTGGCAAGGAGTTCACCATTGACGCTCAGGTTGCCTGGCAGAAACTCGTGGCTGGTGTGGCCAAT

GCCCTGGCCCACAAGTACCACTAA

>Mouse

GTTTACGTTTGCTTCTGATTCTGTTGTGTTGACTTGCAACCTCAGAAACAGACATCATGGTGCACCTGAC

TGATGCTGAGAAGGCTGCTGTCTCTGGCCTGTGGGGAAAGGTGAACGCCGATGAAGTTGGTGGTGAGGCC

CTGGGCAGGCTGCTGGTTGTCTACCCTTGGACCCAGCGGTACTTTGATAGCTTTGGAGACCTATCCTCTG

CCTCTGCTATCATGGGTAATGCCAAAGTGAAGGCCCATGGCAAGAAAGTGATAACTGCCTTTAACGATGG

CCTGAATCACTTGGACAGCCTCAAGGGCACCTTTGCCAGCCTCAGTGAGCTCCACTGTGACAAGCTGCAT

GTGGATCCTGAGAACTTCAGGCTCCTGGGCAATATGATCGTGATTGTGCTGGGCCACCACCTGGGCAAGG

ATTTCACCCCCGCTGCACAGGCTGCCTTCCAGAAGGTGGTGGCTGGAGTGGCTGCTGCCCTGGCTCACAA

GTACCACTAAGCCCCTTTTCTGCTATTGTCTATGCACAAAGGTTATATGTCCCCTAGAGAAAAACTGTCA

ATTGTGGGGAAATGATGAAGACCTTTGGGCATCTAGCTTTTATCTAATAAATGATATTTACTGTCATCCC

>Human

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA

GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC

AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG

CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC

TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT

CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA

CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA

CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT

GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

>Chimp

GGACAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGT

GGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC

CCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG

GCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCT

TTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAA

CGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAG

AAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAAT

TTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGC

ATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

>Chicken

GCTCAGACCTCCTCCGTACCGACAGCCACACGCTACCCTCCAACCGCCGCCATGGTGCACTGGACTGCTG

AGGAGAAGCAGCTCATCACCGGCCTCTGGGGCAAGGTCAATGTGGCCGAATGTGGGGCCGAAGCCCTGGC

CAGGCTGCTGATCGTCTACCCCTGGACCCAGAGGTTCTTTGCGTCCTTTGGGAACCTCTCCAGCCCCACT

GCCATCCTTGGCAACCCCATGGTCCGCGCCCACGGCAAGAAAGTGCTCACCTCCTTTGGGGATGCTGTGA

AGAACCTGGACAACATCAAGAACACCTTCTCCCAACTGTCCGAACTGCATTGTGACAAGCTGCATGTGGA

CCCCGAGAACTTCAGGCTCCTGGGTGACATCCTCATCATTGTCCTGGCCGCCCACTTCAGCAAGGACTTC

ACTCCTGAATGCCAGGCTGCCTGGCAGAAGCTGGTCCGCGTGGTGGCCCATGCCCTGGCTCGCAAGTACC

ACTAAGCACCAGCACCAAAGATCACGGAGCACCTACAACCATTGCATGCACCTGCAGAAATGCTCCGGAG

CTGACAGCTTGTGACAAATAAAGTTCATTCAGTGACACTCA

>Goldfish

GTGGAGTGGACGGATGCTGAGCGAAGTGCCATCATTGGCCTGTGGGGAAAGCTCAATCCCGCTGAACTCG

GACCTCAGGCCCTGGCCAGGTGTCTGATCGTGTATCCCTGGACTCAGAGATATTTCGCCACCTTTGGGAA

CCTGTCAAGCCCCGCTGCAATCATGGGTAACCCCAAGGTGGCAGCTCACGGCAGGACTGTGATGGGAGGT

CTGGAGAGAGCCATCAAGAACATGGATAACATCAAGGCCACCTATGCGCCACTCAGTGTGATGCACTCTG

AGAAATTGCATGTGGATCCCGACAACTTCAGGCTCCTGGCTGATTGCATCACCGTGTGCGCTGCCATGAA

GTTTGGCCCATCTGGGTTCAATGCTGACGTCCAGGAGGCCTGGCAGAAGTTTCTGTGTGTCGTCGTTTCC

GCTCTGTGCAGACAATACCAT

EXPLORING MOLECULAR EVOLUTION

STUDENT WORKSHEET

Results of your pairwise alignment comparing the beta globin gene in humans and in chimps:

1. Data about the alignment can be found below the blue/black alignment chart. How many nucleotides are there in the beta globin gene for:
1. The chimp?

               600

2. The human?

               626

2. A blue asterix indicates that the nucleotides in both sequences are the same, we say they are conserved. What percentage of the beta globin sequence is conserved in chimps and humans? (Don’t include the insertion at the beginning of the human gene). This percentage is often reported as a similarity “score” below the alignment.

               99% similarity between chimps and humans!

3. Would you expect the protein structure to be highly similar or markedly different in the chimp and the human? Explain.

               I think that the protein structure between chimps and humans would be quite similar since their DNA is 99% similar. Their build is much alike. There are a few differences in specific details (such as how much hair), but the proteins would be very much like each other.

RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS

Results of your pairwise alignment comparing the beta globin gene in humans and in chickens:

1. What is the percentage of sequence conservation between the beta globin gene in chickens and humans?

               57%

2. Looking at the two pairwise alignments you have performed, would you expect the beta globin protein found in humans to be more similar to that found in chickens or that found in chimps? Explain.
   
   

              I would expect the protein in humans to be more like that in chimps than chickens. This is because their DNA has been proven to be more alike.

3. Do the results achieved by running these alignments support the results on evolutionary relationships determined by scientists using anatomical homology (similarities)? Explain.  
   
   

               This does support evolutionary relationships that scientists have come up with! It's been said that humans are similar to chimps. But when one thinks about humans being a lot like chickens...things just don't add up. This information proves that humans and chimps are very much alike!

RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS

Results of your multiple sequence alignment comparing the beta globin gene in a variety of animal species:

1. Examine the Unrooted Tree produced.  

Record the species at the end of each branch on the unrooted tree shown below.

2. Based on the information in the unrooted tree:

1. Which two species appear to be most closely related to each other? Explain your choice.

             Humans and chimps appear to be closest related because they are on the same branch.

2. Which two species seem to be the least closely related to each other? Explain your choice.

               The wallaby and the human appear to be quite similar because the wallaby has its own node and the human, two.

3. Comparative evolutionary distance between species is indicated by the length of the clades they are on. Give the comparative evolutionary distance (by percentage similarity “score”) between:

1. The mouse and human

               79% with 630 bp

2. The wallaby and the human

               75% with 444 bp

3. The chimp and the human

               99% with 600 bp

Comment on the significance of these results given your knowledge of mammalian groups.

               Humans are more closely related to chimps than a mouse or wallaby.

RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS

Results of your Rooted Phylogenetic Tree:

1. Examine your Rooted Phylogenetic Tree and record the species at the end of each branch.  

2. Based on this tree diagram, which species is/are most closely related to:

1. The goldfish:

               Chicken

2. The mouse:

               Chimp or human

3. Homology is a term used to refer to a feature in two or more species that is similar because of descent; it evolved from the same feature in the last common ancestor of the species. Hence, similarity in DNA or protein sequences between individuals of the same species or among different species is referred to as sequence homology. Which two species in the tree above share greatest homology with respect to the beta globin gene?

               Human and chimp could be homology.

4. A node is a branch point representing a divergence event from a common ancestor. Which two species have the most ancestral nodes (divergence events) in the tree above? Explain your answer giving the number of nodes leading to these species.

               Human and chimp have the most ancestral nodes. There were two after the first one.

5. Looking at the phylogentic tree above, which two organisms:

1. Diverged from their common ancestor most recently?

               Human and chimp

2. Diverged from their common ancestor least recently?

               Wallaby

6. Draw a modified phylogenetic tree to show how the tree above might change if the beta globin gene for a kangaroo was added to the multiple sequence alignment.

7. It is important to understand that the phylogenetic trees you generated using bioinformatics tools are based on sequence data alone. While sequence relatedness can be very powerful as a predictor of the relatedness of species, other methods must be used in addition to sequence homology, to determine evolutionary relationships. Briefly describe 3 other methods that you think might be used to determine evolutionary relationships.

• The way the species look and reproduce

• Fossils-fossils show lots of different things found that can reveal new species (new...!)

• Breeding-when different animals breed with each other, new species are bound to be born!
  
  

Would You Want To Know?

IF you were to have a disease in the future, would you want to know about it? If there was a way to find out that in 30 years, you will suffer from Alzheimers big time, would you want to know??

Genetic testing and disease: Would you want to know?
In the above article, a story is told about a girl who is on her way to have her genes tested to see if she has inherited the Huntington's gene that her parents have, or if she is at risk of developing it in the future. Huntington's is a pretty nasty disease that makes people lose coordination and get jerky movements and lose control. They can become depressed and psychotic. This all leads to the end, where they develop dementia and have to have complete and total care.

Let's ask this again. If you had a disease like the one presented above...would you want to know?

The Human Genome Project is the organization which research on people's genes goes on in order to figure out whether or not they will have these diseases in the future. Since 2003, this organization has identified over 20,000 genes out there.

But here's something to consider...
Gene testing could become a requirement for everyone in the future. This is so that people can know what to prepare for and expect in the future.

Personally, I don't think I would want to know what the future holds for me. I would imagine that the Human Genome Project costs a lot, so I wouldn't like to put forth all the money that could help with future diseases into FINDING OUT about them. I think that knowing what is to come would give me the chance to figure out what happens in the disease(s) that I would develop and I may fall into a depressed state. I'll let it surprise me later!

Investigating Independent Assortment

INVESTIGATING INDEPENDENT ASSORTMENT

Mendel observed the effects of independent assortment when he carried out his dihybrid crosses. When he crossed two plants that bred true for different versions of two traits, the first-generation offspring all displayed the same phenotype (the dominant phenotype for both traits). However, when these plants were crossed, the second-generation offspring included four different phenotypes.

Mendel carefully recorded the numbers of phenotypes among the offspring of many dihybrid crosses. He found that certain combinations of phenotypes among the second-generation offspring occur in a 9:3:3:1 ratio, on the average. We now know that this pattern occurs because genes on pairs of homologous chromosomes are sorted out for distribution into one gamete or another independently of gene pairs of other chromosomes.

Activity

In this activity, you will first access the meiosis tutorial provided by the University of California, Santa Barbara. The tutorial demonstrates the random assortment of chromosomes into gametes. Next you will complete a tutorial quiz about independent assortment. This is part of The Biology Project from the University of Arizona.

Part 1.

Use your browser to go to the meiosis tutorial at

http://www.sumanasinc.com/webcontent/animations/content/independentassortment.html

Use the tutorial to learn how to determine which allele combinations are possible in two or even three trait crosses.

Part 2.

Use your browser to go to the independent assortment tutorial at
http://www.biology.arizona.edu/mendelian_genetics/problem_sets/dihybrid_cross/dihybrid_cross.html
Go through questions 1-9 of the tutorial. If you answer any question incorrectly, review the tutorial material and try again.
When you have completed this much of the tutorial, answer the questions below:
1. What type of gametes will be produced by a plant of genotype AaBb?
cross, the phenotypic ratio is 9:3:4. There are only three different phenotypes 
for hair color, agouti, black and albino. The individual with genotype recessive 
for both traits, i.e. aabb, has the same albino phenotype as the aaBB and aaBb 
individuals due to epistasis.
2. What type of gametes will be produced by a plant of genotype aabb?
might be caused by the recessive homozygous, recessive bb genotype.

Rather than the 9:3:3:1 seqregation of phenotypes normally seen with an AaBb x AaBb dihybrid 

Same as stated above, only the albino phenotype masks any phenotype that 

3. List all the genotypes you would find among the offspring of an AaBb x aabb test cross.Half of the gametes get a dominant S and a dominant Y allele; the other half of the gametes get a recessive s and a recessive y allele.Both parents produce 25% each of SY, Sy, sY, and sy.

4. What is the expected phenotypic ratio of the offspring of an AaBb x aabb test cross?
These phenotypes will appear in a predicted 1:1s:1:1 ratio.

5. List all possible gametes from a trihybrid individual whose genotype is RrSsTt.
If only recessive traits were scored, we would only consider offspring with one
phenotype: dented, green seeds. A 9:3:3:1 ratio phenotypes would be impossible.