Glowy Glowy Dots!

The piece of DNA provided was called plasmid. The outer part has amp. resistance. There's a hunk of DNA that allows this piece of antibacterial to live in this antibiotic. Green Florescent Protein (which has been known to glow-can make mice glow!) Ara promoter is put next to the green gene. If the DNA is grown in the ara, then it turns on the green gene. For bacteria to turn green, it must be plus (plus vile and negative vile)

Some labelled LB (everything grows on this one!), some LB/amp (tend to have colonies, don't have the resistance gene), and LB/amp/ara (individual colonies, and should glow!)

Here's our steps!
Slap that bacteria on ice! (gently, though!)
include plasmid
heat a little
throw on ice for a heat shock
examine!

So the pictures aren't available, but I will describe them to you! The tube with the living DNA in it grew tons of tiny dots that seemed to glow when under flashlight. But the dead DNA tube looked like toothpaste smudges and had no dots or glow.

It's even been proven that cats with this gene tend to glow under certain light!




So here's a fun thought to leave you with...If you had this gene...

WOULD YOU GLOW...??

Evolution!

So evolution is a pretty big topic in today's society. It's a huge battle between science and religion. Do you believe in evolution? Do you believe in what religious works have to say about it? Can they be combined. That's for you to decide, but the following posts are from the scientific side!

Genetic Sequence Comparisons

The following genetic code sequences were intered into the Biology Workbench website...

>Wallaby

ATGGTGCATCTGACTGCTGAGGAGAAGAACGCCATCACCTCCCTGTGGGGTAAGGTAGCCATTGAACAGA

CTGGTGGTGAGGCTCTTGGCAGGCTGCTCATTGTCTACCCATGGACCTCCAGGTTTTTTGACCATTTTGG

TGACCTATCCAATGCCAAGGCTGTCATGTCAAATCCTAAGGTCCTTGCCCATGGTGCTAAGGTGTTAGTT

GCCTTTGGCGATGCCATCAAGAACCTGGACAACCTGAAGGGTACCTTTGCCAAGCTAAGTGAGCTCCATT

GTGACAAACTGCATGTGGACCCTGAGAACTTCAAGCTCCTGGGGAATATCATTGTGATCTGCTTGGCTGA

GCACTTTGGCAAGGAGTTCACCATTGACGCTCAGGTTGCCTGGCAGAAACTCGTGGCTGGTGTGGCCAAT

GCCCTGGCCCACAAGTACCACTAA

>Mouse

GTTTACGTTTGCTTCTGATTCTGTTGTGTTGACTTGCAACCTCAGAAACAGACATCATGGTGCACCTGAC

TGATGCTGAGAAGGCTGCTGTCTCTGGCCTGTGGGGAAAGGTGAACGCCGATGAAGTTGGTGGTGAGGCC

CTGGGCAGGCTGCTGGTTGTCTACCCTTGGACCCAGCGGTACTTTGATAGCTTTGGAGACCTATCCTCTG

CCTCTGCTATCATGGGTAATGCCAAAGTGAAGGCCCATGGCAAGAAAGTGATAACTGCCTTTAACGATGG

CCTGAATCACTTGGACAGCCTCAAGGGCACCTTTGCCAGCCTCAGTGAGCTCCACTGTGACAAGCTGCAT

GTGGATCCTGAGAACTTCAGGCTCCTGGGCAATATGATCGTGATTGTGCTGGGCCACCACCTGGGCAAGG

ATTTCACCCCCGCTGCACAGGCTGCCTTCCAGAAGGTGGTGGCTGGAGTGGCTGCTGCCCTGGCTCACAA

GTACCACTAAGCCCCTTTTCTGCTATTGTCTATGCACAAAGGTTATATGTCCCCTAGAGAAAAACTGTCA

ATTGTGGGGAAATGATGAAGACCTTTGGGCATCTAGCTTTTATCTAATAAATGATATTTACTGTCATCCC

>Human

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA

GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC

AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG

CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC

TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT

CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA

CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA

CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT

GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

>Chimp

GGACAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGT

GGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGAC

CCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAG

GCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCT

TTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAA

CGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAG

AAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAAT

TTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGC

ATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

>Chicken

GCTCAGACCTCCTCCGTACCGACAGCCACACGCTACCCTCCAACCGCCGCCATGGTGCACTGGACTGCTG

AGGAGAAGCAGCTCATCACCGGCCTCTGGGGCAAGGTCAATGTGGCCGAATGTGGGGCCGAAGCCCTGGC

CAGGCTGCTGATCGTCTACCCCTGGACCCAGAGGTTCTTTGCGTCCTTTGGGAACCTCTCCAGCCCCACT

GCCATCCTTGGCAACCCCATGGTCCGCGCCCACGGCAAGAAAGTGCTCACCTCCTTTGGGGATGCTGTGA

AGAACCTGGACAACATCAAGAACACCTTCTCCCAACTGTCCGAACTGCATTGTGACAAGCTGCATGTGGA

CCCCGAGAACTTCAGGCTCCTGGGTGACATCCTCATCATTGTCCTGGCCGCCCACTTCAGCAAGGACTTC

ACTCCTGAATGCCAGGCTGCCTGGCAGAAGCTGGTCCGCGTGGTGGCCCATGCCCTGGCTCGCAAGTACC

ACTAAGCACCAGCACCAAAGATCACGGAGCACCTACAACCATTGCATGCACCTGCAGAAATGCTCCGGAG

CTGACAGCTTGTGACAAATAAAGTTCATTCAGTGACACTCA

>Goldfish

GTGGAGTGGACGGATGCTGAGCGAAGTGCCATCATTGGCCTGTGGGGAAAGCTCAATCCCGCTGAACTCG

GACCTCAGGCCCTGGCCAGGTGTCTGATCGTGTATCCCTGGACTCAGAGATATTTCGCCACCTTTGGGAA

CCTGTCAAGCCCCGCTGCAATCATGGGTAACCCCAAGGTGGCAGCTCACGGCAGGACTGTGATGGGAGGT

CTGGAGAGAGCCATCAAGAACATGGATAACATCAAGGCCACCTATGCGCCACTCAGTGTGATGCACTCTG

AGAAATTGCATGTGGATCCCGACAACTTCAGGCTCCTGGCTGATTGCATCACCGTGTGCGCTGCCATGAA

GTTTGGCCCATCTGGGTTCAATGCTGACGTCCAGGAGGCCTGGCAGAAGTTTCTGTGTGTCGTCGTTTCC

GCTCTGTGCAGACAATACCAT

EXPLORING MOLECULAR EVOLUTION

STUDENT WORKSHEET

Results of your pairwise alignment comparing the beta globin gene in humans and in chimps:

1. Data about the alignment can be found below the blue/black alignment chart. How many nucleotides are there in the beta globin gene for:
1. The chimp?

               600

2. The human?

               626

2. A blue asterix indicates that the nucleotides in both sequences are the same, we say they are conserved. What percentage of the beta globin sequence is conserved in chimps and humans? (Don’t include the insertion at the beginning of the human gene). This percentage is often reported as a similarity “score” below the alignment.

               99% similarity between chimps and humans!

3. Would you expect the protein structure to be highly similar or markedly different in the chimp and the human? Explain.

               I think that the protein structure between chimps and humans would be quite similar since their DNA is 99% similar. Their build is much alike. There are a few differences in specific details (such as how much hair), but the proteins would be very much like each other.

RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS

Results of your pairwise alignment comparing the beta globin gene in humans and in chickens:

1. What is the percentage of sequence conservation between the beta globin gene in chickens and humans?

               57%

2. Looking at the two pairwise alignments you have performed, would you expect the beta globin protein found in humans to be more similar to that found in chickens or that found in chimps? Explain.
   
   

              I would expect the protein in humans to be more like that in chimps than chickens. This is because their DNA has been proven to be more alike.

3. Do the results achieved by running these alignments support the results on evolutionary relationships determined by scientists using anatomical homology (similarities)? Explain.  
   
   

               This does support evolutionary relationships that scientists have come up with! It's been said that humans are similar to chimps. But when one thinks about humans being a lot like chickens...things just don't add up. This information proves that humans and chimps are very much alike!

RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS

Results of your multiple sequence alignment comparing the beta globin gene in a variety of animal species:

1. Examine the Unrooted Tree produced.  

Record the species at the end of each branch on the unrooted tree shown below.

2. Based on the information in the unrooted tree:

1. Which two species appear to be most closely related to each other? Explain your choice.

             Humans and chimps appear to be closest related because they are on the same branch.

2. Which two species seem to be the least closely related to each other? Explain your choice.

               The wallaby and the human appear to be quite similar because the wallaby has its own node and the human, two.

3. Comparative evolutionary distance between species is indicated by the length of the clades they are on. Give the comparative evolutionary distance (by percentage similarity “score”) between:

1. The mouse and human

               79% with 630 bp

2. The wallaby and the human

               75% with 444 bp

3. The chimp and the human

               99% with 600 bp

Comment on the significance of these results given your knowledge of mammalian groups.

               Humans are more closely related to chimps than a mouse or wallaby.

RETURN TO BIOLOGY WORKBENCH INSTRUCTIONS

Results of your Rooted Phylogenetic Tree:

1. Examine your Rooted Phylogenetic Tree and record the species at the end of each branch.  

2. Based on this tree diagram, which species is/are most closely related to:

1. The goldfish:

               Chicken

2. The mouse:

               Chimp or human

3. Homology is a term used to refer to a feature in two or more species that is similar because of descent; it evolved from the same feature in the last common ancestor of the species. Hence, similarity in DNA or protein sequences between individuals of the same species or among different species is referred to as sequence homology. Which two species in the tree above share greatest homology with respect to the beta globin gene?

               Human and chimp could be homology.

4. A node is a branch point representing a divergence event from a common ancestor. Which two species have the most ancestral nodes (divergence events) in the tree above? Explain your answer giving the number of nodes leading to these species.

               Human and chimp have the most ancestral nodes. There were two after the first one.

5. Looking at the phylogentic tree above, which two organisms:

1. Diverged from their common ancestor most recently?

               Human and chimp

2. Diverged from their common ancestor least recently?

               Wallaby

6. Draw a modified phylogenetic tree to show how the tree above might change if the beta globin gene for a kangaroo was added to the multiple sequence alignment.

7. It is important to understand that the phylogenetic trees you generated using bioinformatics tools are based on sequence data alone. While sequence relatedness can be very powerful as a predictor of the relatedness of species, other methods must be used in addition to sequence homology, to determine evolutionary relationships. Briefly describe 3 other methods that you think might be used to determine evolutionary relationships.

• The way the species look and reproduce

• Fossils-fossils show lots of different things found that can reveal new species (new...!)

• Breeding-when different animals breed with each other, new species are bound to be born!
  
  

Would You Want To Know?

IF you were to have a disease in the future, would you want to know about it? If there was a way to find out that in 30 years, you will suffer from Alzheimers big time, would you want to know??

Genetic testing and disease: Would you want to know?
In the above article, a story is told about a girl who is on her way to have her genes tested to see if she has inherited the Huntington's gene that her parents have, or if she is at risk of developing it in the future. Huntington's is a pretty nasty disease that makes people lose coordination and get jerky movements and lose control. They can become depressed and psychotic. This all leads to the end, where they develop dementia and have to have complete and total care.

Let's ask this again. If you had a disease like the one presented above...would you want to know?

The Human Genome Project is the organization which research on people's genes goes on in order to figure out whether or not they will have these diseases in the future. Since 2003, this organization has identified over 20,000 genes out there.

But here's something to consider...
Gene testing could become a requirement for everyone in the future. This is so that people can know what to prepare for and expect in the future.

Personally, I don't think I would want to know what the future holds for me. I would imagine that the Human Genome Project costs a lot, so I wouldn't like to put forth all the money that could help with future diseases into FINDING OUT about them. I think that knowing what is to come would give me the chance to figure out what happens in the disease(s) that I would develop and I may fall into a depressed state. I'll let it surprise me later!

Questions about GATTACA!

Questions about GATTACA!

Choose several of the following questions to discuss in a blog post reflection on the movie GATTACA. This reflection will become an artifact on your portfolio page 2 as part of your awareness of the effects of science upon society.

1. The following terms were used in the movie. How do they relate to the words we use: degenerate and invalid?

        De-gene-erate: His genes weren't the same as they were recorded as so that he could do what he did.

        In-valid: He's just not right for the position because his DNA wasn't "right", or "valid".

        Borrowed Ladder: The main character borrowed genes and DNA from his brother.

2. Why do you think Vincent left his family, tearing his picture out of the family photo, after winning the swimming race against his brother?

Vincent still didn't have that good feeling of belonging. He thought winning the contest would make him feel better, but he just felt bad about it still, wanting to be like his brother, and be able to go into space. But his DNA still said he wasn't good enough for it.

3. Describe the relationship between Vincent and Anton.

The two are brothers, so sharing DNA wouldn't be as incredibly hard as complete strangers. But the two shared will power. The older brother always won the races when they two went swimming, but Vincent had the will power and showed Anton that he could do anything he could do, too.

4. When Jerome Morrow said to Vincent/Jerome, “They’re not looking for you. When they look at you, they only see me,” what did he mean? Can you find any parallels to this type of situation in real life?

When "they" look at Vincent, they only see Jerome Morrow. This is because he had to use other DNA than his own to get to where he was with the space studies and to be involved. In real life, I don't think of using someone else's DNA, but perhaps when someone uses another person's techniques, it is recognized. Like dancing. If I studied under the same teacher my entire dancing career, chances would be that we would share similar dance interests and techniques.

5. Choose your favorite character from the film. Explain why you choose that person. Would you want to be that person? Why? Why not?

My favorite character from this film would have to have been Vincent. I choose him because it was interesting that he went to such lengths to get what he wanted, and to see just how badly he wanted to be involved and feel the feeling of belonging, and how it changed his life. I don't think I would want to be him. I'm not too interested in space, and I wouldn't want to have to hide a secret of borrowing DNA to get to where I want to be. I think I would bust and try to confess to someone.

6. At the end of the film, you are told that the Doctor knew about Vincent all along. Why did the Doctor go along with the fraud? What would you have done if you were the Doctor?

I think the Doctor went along with the fraud because he believed in Vincent. He believed that he could make it, but that his DNA was all that was holding him back. I think I would have done the same thing, but made sure that his original DNA would be alright, too, so that if anything happened, there wouldn't be any troubles.

7. The technology to do what was done in the movie is definitely possible within the next fifty years. Do you think that Vincent’s world could eventually happen in America? Why?

Definitely. The world is under constant change and there's no telling what the future may hold. We can only imagine it.

8. What do you think is wrong with the society portrayed in "GATTACA"? What is right?

 The people are setting things at too strict a setting. So strict that even the slightest difference in DNA will prevent people from getting to where they want to be in life. Some of the people even give in and commit suicide, thinking that they aren't worthy because of one mistake they may have made or have no control of.

9. What were the screenwriters trying to tell us through the episode of the 12-fingered pianist? Is anything wrong with engineering children to have 12 fingers if, as a result, they will be able to make extraordinarily beautiful music?

Every person has a chance to make it somewhere in their life. All they have to do is believe and try, and they can make it anywhere.

10. You and your spouse are having a child and are at the Genetic Clinic pictured in the movie. What characteristics would you want for your child and what would you ask to be excluded? Why would you make those choices?

 If I were to be going to a clinic much like the one in this movie, I would want my child to be very good at math and science. I'd want them to have talent in art. I would absolutely want them to have ability to hear music and dance. Too feel the music. But I would not want them to have the characteristics that would make them feel the need to be wanted. I would want my children to be independent and strong. I want them to be able to do something without the world making things more difficult than they had to be.

11. Picture yourself as either Vincent, Jerome, or Anton. Would you have acted the same or done things differently if you were in the same world as them?

If I were Vincent, I probably would have done the same. It is an extremely wicked idea and I can't imagine myself using someone else's DNA to get to where I want to be, but I do know that when I want something really bad, I will fight for it until I can accomplish just that.

12. How does the society in GATTACA resemble the type of society America was during the height of the eugenics movement?

DNA. Scientific theories. Everything has to be proven.